ID: 1026204069

View in Genome Browser
Species Human (GRCh38)
Location 7:68240183-68240205
Sequence GGCACTGCCTCCTCTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026204063_1026204069 8 Left 1026204063 7:68240152-68240174 CCTGTCTTGTATCTAAGCCCTGG No data
Right 1026204069 7:68240183-68240205 GGCACTGCCTCCTCTAGAGTGGG No data
1026204066_1026204069 -9 Left 1026204066 7:68240169-68240191 CCCTGGTCTTTACTGGCACTGCC No data
Right 1026204069 7:68240183-68240205 GGCACTGCCTCCTCTAGAGTGGG No data
1026204067_1026204069 -10 Left 1026204067 7:68240170-68240192 CCTGGTCTTTACTGGCACTGCCT No data
Right 1026204069 7:68240183-68240205 GGCACTGCCTCCTCTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026204069 Original CRISPR GGCACTGCCTCCTCTAGAGT GGG Intergenic
No off target data available for this crispr