ID: 1026204129

View in Genome Browser
Species Human (GRCh38)
Location 7:68240800-68240822
Sequence CTCAGTGTACTTTGTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026204129_1026204140 -2 Left 1026204129 7:68240800-68240822 CCCCCATTACAAAGTACACTGAG No data
Right 1026204140 7:68240821-68240843 AGGGTAGTCTCAGGGGCGAGGGG No data
1026204129_1026204142 2 Left 1026204129 7:68240800-68240822 CCCCCATTACAAAGTACACTGAG No data
Right 1026204142 7:68240825-68240847 TAGTCTCAGGGGCGAGGGGTGGG No data
1026204129_1026204136 -10 Left 1026204129 7:68240800-68240822 CCCCCATTACAAAGTACACTGAG No data
Right 1026204136 7:68240813-68240835 GTACACTGAGGGTAGTCTCAGGG No data
1026204129_1026204137 -9 Left 1026204129 7:68240800-68240822 CCCCCATTACAAAGTACACTGAG No data
Right 1026204137 7:68240814-68240836 TACACTGAGGGTAGTCTCAGGGG No data
1026204129_1026204141 1 Left 1026204129 7:68240800-68240822 CCCCCATTACAAAGTACACTGAG No data
Right 1026204141 7:68240824-68240846 GTAGTCTCAGGGGCGAGGGGTGG No data
1026204129_1026204138 -4 Left 1026204129 7:68240800-68240822 CCCCCATTACAAAGTACACTGAG No data
Right 1026204138 7:68240819-68240841 TGAGGGTAGTCTCAGGGGCGAGG No data
1026204129_1026204143 3 Left 1026204129 7:68240800-68240822 CCCCCATTACAAAGTACACTGAG No data
Right 1026204143 7:68240826-68240848 AGTCTCAGGGGCGAGGGGTGGGG No data
1026204129_1026204139 -3 Left 1026204129 7:68240800-68240822 CCCCCATTACAAAGTACACTGAG No data
Right 1026204139 7:68240820-68240842 GAGGGTAGTCTCAGGGGCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026204129 Original CRISPR CTCAGTGTACTTTGTAATGG GGG (reversed) Intergenic
No off target data available for this crispr