ID: 1026205266

View in Genome Browser
Species Human (GRCh38)
Location 7:68251807-68251829
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026205266_1026205273 -2 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205273 7:68251828-68251850 TTCTGAGGAATCAAGGATGATGG No data
1026205266_1026205272 -9 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205272 7:68251821-68251843 TGGATCATTCTGAGGAATCAAGG No data
1026205266_1026205275 19 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205275 7:68251849-68251871 GGTGAAGGCACTAGCTTTCCAGG No data
1026205266_1026205277 30 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205277 7:68251860-68251882 TAGCTTTCCAGGACTCCCCTGGG No data
1026205266_1026205274 4 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205274 7:68251834-68251856 GGAATCAAGGATGATGGTGAAGG No data
1026205266_1026205276 29 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026205266 Original CRISPR AATGATCCAGGAACATGGAG GGG (reversed) Intergenic
No off target data available for this crispr