ID: 1026205268

View in Genome Browser
Species Human (GRCh38)
Location 7:68251809-68251831
Sequence AGAATGATCCAGGAACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026205268_1026205274 2 Left 1026205268 7:68251809-68251831 CCTCCATGTTCCTGGATCATTCT No data
Right 1026205274 7:68251834-68251856 GGAATCAAGGATGATGGTGAAGG No data
1026205268_1026205276 27 Left 1026205268 7:68251809-68251831 CCTCCATGTTCCTGGATCATTCT No data
Right 1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG No data
1026205268_1026205275 17 Left 1026205268 7:68251809-68251831 CCTCCATGTTCCTGGATCATTCT No data
Right 1026205275 7:68251849-68251871 GGTGAAGGCACTAGCTTTCCAGG No data
1026205268_1026205277 28 Left 1026205268 7:68251809-68251831 CCTCCATGTTCCTGGATCATTCT No data
Right 1026205277 7:68251860-68251882 TAGCTTTCCAGGACTCCCCTGGG No data
1026205268_1026205273 -4 Left 1026205268 7:68251809-68251831 CCTCCATGTTCCTGGATCATTCT No data
Right 1026205273 7:68251828-68251850 TTCTGAGGAATCAAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026205268 Original CRISPR AGAATGATCCAGGAACATGG AGG (reversed) Intergenic
No off target data available for this crispr