ID: 1026205271

View in Genome Browser
Species Human (GRCh38)
Location 7:68251819-68251841
Sequence TTGATTCCTCAGAATGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026205271_1026205276 17 Left 1026205271 7:68251819-68251841 CCTGGATCATTCTGAGGAATCAA No data
Right 1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG No data
1026205271_1026205277 18 Left 1026205271 7:68251819-68251841 CCTGGATCATTCTGAGGAATCAA No data
Right 1026205277 7:68251860-68251882 TAGCTTTCCAGGACTCCCCTGGG No data
1026205271_1026205274 -8 Left 1026205271 7:68251819-68251841 CCTGGATCATTCTGAGGAATCAA No data
Right 1026205274 7:68251834-68251856 GGAATCAAGGATGATGGTGAAGG No data
1026205271_1026205275 7 Left 1026205271 7:68251819-68251841 CCTGGATCATTCTGAGGAATCAA No data
Right 1026205275 7:68251849-68251871 GGTGAAGGCACTAGCTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026205271 Original CRISPR TTGATTCCTCAGAATGATCC AGG (reversed) Intergenic
No off target data available for this crispr