ID: 1026205272

View in Genome Browser
Species Human (GRCh38)
Location 7:68251821-68251843
Sequence TGGATCATTCTGAGGAATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026205267_1026205272 -10 Left 1026205267 7:68251808-68251830 CCCTCCATGTTCCTGGATCATTC No data
Right 1026205272 7:68251821-68251843 TGGATCATTCTGAGGAATCAAGG No data
1026205262_1026205272 22 Left 1026205262 7:68251776-68251798 CCTTATCTCATGCACTGGGTTAG No data
Right 1026205272 7:68251821-68251843 TGGATCATTCTGAGGAATCAAGG No data
1026205265_1026205272 -5 Left 1026205265 7:68251803-68251825 CCTACCCCTCCATGTTCCTGGAT No data
Right 1026205272 7:68251821-68251843 TGGATCATTCTGAGGAATCAAGG No data
1026205266_1026205272 -9 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205272 7:68251821-68251843 TGGATCATTCTGAGGAATCAAGG No data
1026205260_1026205272 26 Left 1026205260 7:68251772-68251794 CCATCCTTATCTCATGCACTGGG No data
Right 1026205272 7:68251821-68251843 TGGATCATTCTGAGGAATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026205272 Original CRISPR TGGATCATTCTGAGGAATCA AGG Intergenic
No off target data available for this crispr