ID: 1026205273

View in Genome Browser
Species Human (GRCh38)
Location 7:68251828-68251850
Sequence TTCTGAGGAATCAAGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026205266_1026205273 -2 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205273 7:68251828-68251850 TTCTGAGGAATCAAGGATGATGG No data
1026205265_1026205273 2 Left 1026205265 7:68251803-68251825 CCTACCCCTCCATGTTCCTGGAT No data
Right 1026205273 7:68251828-68251850 TTCTGAGGAATCAAGGATGATGG No data
1026205269_1026205273 -7 Left 1026205269 7:68251812-68251834 CCATGTTCCTGGATCATTCTGAG No data
Right 1026205273 7:68251828-68251850 TTCTGAGGAATCAAGGATGATGG No data
1026205267_1026205273 -3 Left 1026205267 7:68251808-68251830 CCCTCCATGTTCCTGGATCATTC No data
Right 1026205273 7:68251828-68251850 TTCTGAGGAATCAAGGATGATGG No data
1026205262_1026205273 29 Left 1026205262 7:68251776-68251798 CCTTATCTCATGCACTGGGTTAG No data
Right 1026205273 7:68251828-68251850 TTCTGAGGAATCAAGGATGATGG No data
1026205268_1026205273 -4 Left 1026205268 7:68251809-68251831 CCTCCATGTTCCTGGATCATTCT No data
Right 1026205273 7:68251828-68251850 TTCTGAGGAATCAAGGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026205273 Original CRISPR TTCTGAGGAATCAAGGATGA TGG Intergenic
No off target data available for this crispr