ID: 1026205276

View in Genome Browser
Species Human (GRCh38)
Location 7:68251859-68251881
Sequence CTAGCTTTCCAGGACTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026205267_1026205276 28 Left 1026205267 7:68251808-68251830 CCCTCCATGTTCCTGGATCATTC No data
Right 1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG No data
1026205271_1026205276 17 Left 1026205271 7:68251819-68251841 CCTGGATCATTCTGAGGAATCAA No data
Right 1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG No data
1026205268_1026205276 27 Left 1026205268 7:68251809-68251831 CCTCCATGTTCCTGGATCATTCT No data
Right 1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG No data
1026205266_1026205276 29 Left 1026205266 7:68251807-68251829 CCCCTCCATGTTCCTGGATCATT No data
Right 1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG No data
1026205269_1026205276 24 Left 1026205269 7:68251812-68251834 CCATGTTCCTGGATCATTCTGAG No data
Right 1026205276 7:68251859-68251881 CTAGCTTTCCAGGACTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026205276 Original CRISPR CTAGCTTTCCAGGACTCCCC TGG Intergenic
No off target data available for this crispr