ID: 1026206297

View in Genome Browser
Species Human (GRCh38)
Location 7:68260709-68260731
Sequence AAGGGAAAGAAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026206297_1026206303 14 Left 1026206297 7:68260709-68260731 CCATCCTCCTTCTTCTTTCCCTT No data
Right 1026206303 7:68260746-68260768 ATCACCTCTGTTGACCTCCTTGG No data
1026206297_1026206305 26 Left 1026206297 7:68260709-68260731 CCATCCTCCTTCTTCTTTCCCTT No data
Right 1026206305 7:68260758-68260780 GACCTCCTTGGATCTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026206297 Original CRISPR AAGGGAAAGAAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr