ID: 1026209838

View in Genome Browser
Species Human (GRCh38)
Location 7:68294331-68294353
Sequence TCCTGATGGCTTTGCTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026209838_1026209842 25 Left 1026209838 7:68294331-68294353 CCAGTGCAGCAAAGCCATCAGGA No data
Right 1026209842 7:68294379-68294401 AAAGTGAAGCATTTATTTGCAGG No data
1026209838_1026209843 26 Left 1026209838 7:68294331-68294353 CCAGTGCAGCAAAGCCATCAGGA No data
Right 1026209843 7:68294380-68294402 AAGTGAAGCATTTATTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026209838 Original CRISPR TCCTGATGGCTTTGCTGCAC TGG (reversed) Intergenic