ID: 1026213151

View in Genome Browser
Species Human (GRCh38)
Location 7:68324514-68324536
Sequence CAATAGGAGCACCTTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026213143_1026213151 17 Left 1026213143 7:68324474-68324496 CCGCCATCTTGGGAGCTCTGTGA 0: 27
1: 158
2: 165
3: 111
4: 255
Right 1026213151 7:68324514-68324536 CAATAGGAGCACCTTCCCCCAGG No data
1026213144_1026213151 14 Left 1026213144 7:68324477-68324499 CCATCTTGGGAGCTCTGTGAGCA 0: 28
1: 160
2: 84
3: 160
4: 287
Right 1026213151 7:68324514-68324536 CAATAGGAGCACCTTCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026213151 Original CRISPR CAATAGGAGCACCTTCCCCC AGG Intergenic
No off target data available for this crispr