ID: 1026213599

View in Genome Browser
Species Human (GRCh38)
Location 7:68328626-68328648
Sequence CAGCCAGGTTGCCCGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026213594_1026213599 15 Left 1026213594 7:68328588-68328610 CCTCTTCCAAATGAATACCTGTC No data
Right 1026213599 7:68328626-68328648 CAGCCAGGTTGCCCGTGGAGAGG No data
1026213596_1026213599 -2 Left 1026213596 7:68328605-68328627 CCTGTCACTAATATTATGCATCA No data
Right 1026213599 7:68328626-68328648 CAGCCAGGTTGCCCGTGGAGAGG No data
1026213595_1026213599 9 Left 1026213595 7:68328594-68328616 CCAAATGAATACCTGTCACTAAT No data
Right 1026213599 7:68328626-68328648 CAGCCAGGTTGCCCGTGGAGAGG No data
1026213593_1026213599 16 Left 1026213593 7:68328587-68328609 CCCTCTTCCAAATGAATACCTGT No data
Right 1026213599 7:68328626-68328648 CAGCCAGGTTGCCCGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026213599 Original CRISPR CAGCCAGGTTGCCCGTGGAG AGG Intergenic
No off target data available for this crispr