ID: 1026216258

View in Genome Browser
Species Human (GRCh38)
Location 7:68352005-68352027
Sequence ATAAGTTATCTGGGGGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026216258_1026216267 21 Left 1026216258 7:68352005-68352027 CCAAACTCCCCCAGATAACTTAT No data
Right 1026216267 7:68352049-68352071 AAGATCCATTTTTCCACCCTTGG No data
1026216258_1026216268 22 Left 1026216258 7:68352005-68352027 CCAAACTCCCCCAGATAACTTAT No data
Right 1026216268 7:68352050-68352072 AGATCCATTTTTCCACCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026216258 Original CRISPR ATAAGTTATCTGGGGGAGTT TGG (reversed) Intergenic
No off target data available for this crispr