ID: 1026224798

View in Genome Browser
Species Human (GRCh38)
Location 7:68430801-68430823
Sequence GACTCACGGTTCCACAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026224798_1026224804 16 Left 1026224798 7:68430801-68430823 CCAGCCCTGTGGAACCGTGAGTC No data
Right 1026224804 7:68430840-68430862 TTTATAAATTACCCAGTCTTGGG 0: 2548
1: 10465
2: 14335
3: 13164
4: 9470
1026224798_1026224803 15 Left 1026224798 7:68430801-68430823 CCAGCCCTGTGGAACCGTGAGTC No data
Right 1026224803 7:68430839-68430861 CTTTATAAATTACCCAGTCTTGG 0: 3429
1: 4465
2: 3325
3: 3035
4: 2495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026224798 Original CRISPR GACTCACGGTTCCACAGGGC TGG (reversed) Intergenic
No off target data available for this crispr