ID: 1026227230

View in Genome Browser
Species Human (GRCh38)
Location 7:68453054-68453076
Sequence CATTGTGTACAGAGGGTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026227221_1026227230 24 Left 1026227221 7:68453007-68453029 CCAGCCTATTCTATCTATTTTTA No data
Right 1026227230 7:68453054-68453076 CATTGTGTACAGAGGGTGAGGGG No data
1026227220_1026227230 25 Left 1026227220 7:68453006-68453028 CCCAGCCTATTCTATCTATTTTT No data
Right 1026227230 7:68453054-68453076 CATTGTGTACAGAGGGTGAGGGG No data
1026227219_1026227230 30 Left 1026227219 7:68453001-68453023 CCGCACCCAGCCTATTCTATCTA No data
Right 1026227230 7:68453054-68453076 CATTGTGTACAGAGGGTGAGGGG No data
1026227222_1026227230 20 Left 1026227222 7:68453011-68453033 CCTATTCTATCTATTTTTATTGT No data
Right 1026227230 7:68453054-68453076 CATTGTGTACAGAGGGTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026227230 Original CRISPR CATTGTGTACAGAGGGTGAG GGG Intergenic
No off target data available for this crispr