ID: 1026229947

View in Genome Browser
Species Human (GRCh38)
Location 7:68473961-68473983
Sequence AAAGCACTTAGAACCACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026229945_1026229947 19 Left 1026229945 7:68473919-68473941 CCATCTTAAAGGGTTGTGAAAAA No data
Right 1026229947 7:68473961-68473983 AAAGCACTTAGAACCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026229947 Original CRISPR AAAGCACTTAGAACCACTCC TGG Intergenic
No off target data available for this crispr