ID: 1026233638

View in Genome Browser
Species Human (GRCh38)
Location 7:68507483-68507505
Sequence GTGGACTCTGCCTCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026233638_1026233643 10 Left 1026233638 7:68507483-68507505 CCCACAAAGGAGGCAGAGTCCAC No data
Right 1026233643 7:68507516-68507538 AGAGATATGTATCTCCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026233638 Original CRISPR GTGGACTCTGCCTCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr