ID: 1026233643

View in Genome Browser
Species Human (GRCh38)
Location 7:68507516-68507538
Sequence AGAGATATGTATCTCCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026233639_1026233643 9 Left 1026233639 7:68507484-68507506 CCACAAAGGAGGCAGAGTCCACA No data
Right 1026233643 7:68507516-68507538 AGAGATATGTATCTCCTCCAAGG No data
1026233640_1026233643 -9 Left 1026233640 7:68507502-68507524 CCACAGAAATCCCTAGAGATATG No data
Right 1026233643 7:68507516-68507538 AGAGATATGTATCTCCTCCAAGG No data
1026233638_1026233643 10 Left 1026233638 7:68507483-68507505 CCCACAAAGGAGGCAGAGTCCAC No data
Right 1026233643 7:68507516-68507538 AGAGATATGTATCTCCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026233643 Original CRISPR AGAGATATGTATCTCCTCCA AGG Intergenic
No off target data available for this crispr