ID: 1026235582

View in Genome Browser
Species Human (GRCh38)
Location 7:68524093-68524115
Sequence TGCAATCATCCGAAAGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026235582_1026235587 26 Left 1026235582 7:68524093-68524115 CCTCACCCTTTCGGATGATTGCA No data
Right 1026235587 7:68524142-68524164 CGTGAGTCTGATTGGTTCTGTGG No data
1026235582_1026235586 18 Left 1026235582 7:68524093-68524115 CCTCACCCTTTCGGATGATTGCA No data
Right 1026235586 7:68524134-68524156 ACTCTGTGCGTGAGTCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026235582 Original CRISPR TGCAATCATCCGAAAGGGTG AGG (reversed) Intergenic
No off target data available for this crispr