ID: 1026237252

View in Genome Browser
Species Human (GRCh38)
Location 7:68538140-68538162
Sequence TGGTGCCATCTCGGGCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026237252_1026237257 7 Left 1026237252 7:68538140-68538162 CCAGACAGCCCGAGATGGCACCA No data
Right 1026237257 7:68538170-68538192 TTGATCCCTAACCCGATACTGGG No data
1026237252_1026237256 6 Left 1026237252 7:68538140-68538162 CCAGACAGCCCGAGATGGCACCA No data
Right 1026237256 7:68538169-68538191 CTTGATCCCTAACCCGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026237252 Original CRISPR TGGTGCCATCTCGGGCTGTC TGG (reversed) Intergenic
No off target data available for this crispr