ID: 1026240963

View in Genome Browser
Species Human (GRCh38)
Location 7:68574868-68574890
Sequence GTGCCCAGCCCAATAAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026240956_1026240963 14 Left 1026240956 7:68574831-68574853 CCTCCCAGAAGTGCTGGGATTAC 0: 31
1: 720
2: 1410
3: 4133
4: 4894
Right 1026240963 7:68574868-68574890 GTGCCCAGCCCAATAAGCCAGGG No data
1026240959_1026240963 10 Left 1026240959 7:68574835-68574857 CCAGAAGTGCTGGGATTACAGGC 0: 4742
1: 224904
2: 276751
3: 269024
4: 314877
Right 1026240963 7:68574868-68574890 GTGCCCAGCCCAATAAGCCAGGG No data
1026240953_1026240963 23 Left 1026240953 7:68574822-68574844 CCTCTTCTGCCTCCCAGAAGTGC No data
Right 1026240963 7:68574868-68574890 GTGCCCAGCCCAATAAGCCAGGG No data
1026240952_1026240963 24 Left 1026240952 7:68574821-68574843 CCCTCTTCTGCCTCCCAGAAGTG No data
Right 1026240963 7:68574868-68574890 GTGCCCAGCCCAATAAGCCAGGG No data
1026240951_1026240963 25 Left 1026240951 7:68574820-68574842 CCCCTCTTCTGCCTCCCAGAAGT No data
Right 1026240963 7:68574868-68574890 GTGCCCAGCCCAATAAGCCAGGG No data
1026240957_1026240963 11 Left 1026240957 7:68574834-68574856 CCCAGAAGTGCTGGGATTACAGG 0: 41
1: 1014
2: 5509
3: 6192
4: 7599
Right 1026240963 7:68574868-68574890 GTGCCCAGCCCAATAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026240963 Original CRISPR GTGCCCAGCCCAATAAGCCA GGG Intergenic
No off target data available for this crispr