ID: 1026245215

View in Genome Browser
Species Human (GRCh38)
Location 7:68613556-68613578
Sequence TTACATAGCCATAGCGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026245215_1026245217 -10 Left 1026245215 7:68613556-68613578 CCCTGCACGCTATGGCTATGTAA No data
Right 1026245217 7:68613569-68613591 GGCTATGTAAACGTCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026245215 Original CRISPR TTACATAGCCATAGCGTGCA GGG (reversed) Intergenic
No off target data available for this crispr