ID: 1026252990

View in Genome Browser
Species Human (GRCh38)
Location 7:68687016-68687038
Sequence TAGGCAGGACCAGCCCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026252986_1026252990 23 Left 1026252986 7:68686970-68686992 CCTGTCGTGCAGTCAGTCATTCA No data
Right 1026252990 7:68687016-68687038 TAGGCAGGACCAGCCCAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026252990 Original CRISPR TAGGCAGGACCAGCCCAAAC TGG Intergenic
No off target data available for this crispr