ID: 1026253253

View in Genome Browser
Species Human (GRCh38)
Location 7:68689281-68689303
Sequence GTGGGCCAAGTCTTCATTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026253253_1026253260 4 Left 1026253253 7:68689281-68689303 CCGCAAATGAAGACTTGGCCCAC No data
Right 1026253260 7:68689308-68689330 AGCCTGATTGGTTGTAGGAGGGG No data
1026253253_1026253257 -1 Left 1026253253 7:68689281-68689303 CCGCAAATGAAGACTTGGCCCAC No data
Right 1026253257 7:68689303-68689325 CGATCAGCCTGATTGGTTGTAGG No data
1026253253_1026253259 3 Left 1026253253 7:68689281-68689303 CCGCAAATGAAGACTTGGCCCAC No data
Right 1026253259 7:68689307-68689329 CAGCCTGATTGGTTGTAGGAGGG No data
1026253253_1026253262 13 Left 1026253253 7:68689281-68689303 CCGCAAATGAAGACTTGGCCCAC No data
Right 1026253262 7:68689317-68689339 GGTTGTAGGAGGGGACCAACTGG No data
1026253253_1026253258 2 Left 1026253253 7:68689281-68689303 CCGCAAATGAAGACTTGGCCCAC No data
Right 1026253258 7:68689306-68689328 TCAGCCTGATTGGTTGTAGGAGG No data
1026253253_1026253254 -8 Left 1026253253 7:68689281-68689303 CCGCAAATGAAGACTTGGCCCAC No data
Right 1026253254 7:68689296-68689318 TGGCCCACGATCAGCCTGATTGG No data
1026253253_1026253263 16 Left 1026253253 7:68689281-68689303 CCGCAAATGAAGACTTGGCCCAC No data
Right 1026253263 7:68689320-68689342 TGTAGGAGGGGACCAACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026253253 Original CRISPR GTGGGCCAAGTCTTCATTTG CGG (reversed) Intergenic
No off target data available for this crispr