ID: 1026254821

View in Genome Browser
Species Human (GRCh38)
Location 7:68701730-68701752
Sequence ATAATCAGTACAGTGTACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026254821_1026254825 7 Left 1026254821 7:68701730-68701752 CCACGGTACACTGTACTGATTAT No data
Right 1026254825 7:68701760-68701782 TACTGCTTCTCTCAGGGATGAGG No data
1026254821_1026254826 24 Left 1026254821 7:68701730-68701752 CCACGGTACACTGTACTGATTAT No data
Right 1026254826 7:68701777-68701799 ATGAGGAAAAATCTATAATCTGG No data
1026254821_1026254823 1 Left 1026254821 7:68701730-68701752 CCACGGTACACTGTACTGATTAT No data
Right 1026254823 7:68701754-68701776 GTCCTGTACTGCTTCTCTCAGGG No data
1026254821_1026254822 0 Left 1026254821 7:68701730-68701752 CCACGGTACACTGTACTGATTAT No data
Right 1026254822 7:68701753-68701775 TGTCCTGTACTGCTTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026254821 Original CRISPR ATAATCAGTACAGTGTACCG TGG (reversed) Intergenic