ID: 1026254822

View in Genome Browser
Species Human (GRCh38)
Location 7:68701753-68701775
Sequence TGTCCTGTACTGCTTCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026254817_1026254822 29 Left 1026254817 7:68701701-68701723 CCAGAAATCAGAAACCAGACAGA No data
Right 1026254822 7:68701753-68701775 TGTCCTGTACTGCTTCTCTCAGG No data
1026254821_1026254822 0 Left 1026254821 7:68701730-68701752 CCACGGTACACTGTACTGATTAT No data
Right 1026254822 7:68701753-68701775 TGTCCTGTACTGCTTCTCTCAGG No data
1026254820_1026254822 6 Left 1026254820 7:68701724-68701746 CCAACTCCACGGTACACTGTACT No data
Right 1026254822 7:68701753-68701775 TGTCCTGTACTGCTTCTCTCAGG No data
1026254819_1026254822 15 Left 1026254819 7:68701715-68701737 CCAGACAGACCAACTCCACGGTA No data
Right 1026254822 7:68701753-68701775 TGTCCTGTACTGCTTCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026254822 Original CRISPR TGTCCTGTACTGCTTCTCTC AGG Intergenic