ID: 1026254826

View in Genome Browser
Species Human (GRCh38)
Location 7:68701777-68701799
Sequence ATGAGGAAAAATCTATAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026254820_1026254826 30 Left 1026254820 7:68701724-68701746 CCAACTCCACGGTACACTGTACT No data
Right 1026254826 7:68701777-68701799 ATGAGGAAAAATCTATAATCTGG No data
1026254824_1026254826 -2 Left 1026254824 7:68701756-68701778 CCTGTACTGCTTCTCTCAGGGAT No data
Right 1026254826 7:68701777-68701799 ATGAGGAAAAATCTATAATCTGG No data
1026254821_1026254826 24 Left 1026254821 7:68701730-68701752 CCACGGTACACTGTACTGATTAT No data
Right 1026254826 7:68701777-68701799 ATGAGGAAAAATCTATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026254826 Original CRISPR ATGAGGAAAAATCTATAATC TGG Intergenic