ID: 1026261765

View in Genome Browser
Species Human (GRCh38)
Location 7:68761592-68761614
Sequence TTGAGTACACAATGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026261762_1026261765 19 Left 1026261762 7:68761550-68761572 CCAGGGTGAGACCCTGTGTTTTC No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data
1026261756_1026261765 25 Left 1026261756 7:68761544-68761566 CCCCCCCCAGGGTGAGACCCTGT No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data
1026261761_1026261765 20 Left 1026261761 7:68761549-68761571 CCCAGGGTGAGACCCTGTGTTTT No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data
1026261759_1026261765 22 Left 1026261759 7:68761547-68761569 CCCCCAGGGTGAGACCCTGTGTT No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data
1026261760_1026261765 21 Left 1026261760 7:68761548-68761570 CCCCAGGGTGAGACCCTGTGTTT No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data
1026261757_1026261765 24 Left 1026261757 7:68761545-68761567 CCCCCCCAGGGTGAGACCCTGTG No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data
1026261763_1026261765 8 Left 1026261763 7:68761561-68761583 CCCTGTGTTTTCTCTGAACAGAA No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data
1026261758_1026261765 23 Left 1026261758 7:68761546-68761568 CCCCCCAGGGTGAGACCCTGTGT No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data
1026261764_1026261765 7 Left 1026261764 7:68761562-68761584 CCTGTGTTTTCTCTGAACAGAAT No data
Right 1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026261765 Original CRISPR TTGAGTACACAATGCCATCT TGG Intergenic
No off target data available for this crispr