ID: 1026277016

View in Genome Browser
Species Human (GRCh38)
Location 7:68888897-68888919
Sequence TCCTTGGAGAGCTGTGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026277016_1026277022 13 Left 1026277016 7:68888897-68888919 CCACTGTCACAGCTCTCCAAGGA No data
Right 1026277022 7:68888933-68888955 CTGTGCTTTTAGAATTGGGCAGG No data
1026277016_1026277024 26 Left 1026277016 7:68888897-68888919 CCACTGTCACAGCTCTCCAAGGA No data
Right 1026277024 7:68888946-68888968 ATTGGGCAGGGAACGTAGAGTGG No data
1026277016_1026277023 14 Left 1026277016 7:68888897-68888919 CCACTGTCACAGCTCTCCAAGGA No data
Right 1026277023 7:68888934-68888956 TGTGCTTTTAGAATTGGGCAGGG No data
1026277016_1026277020 9 Left 1026277016 7:68888897-68888919 CCACTGTCACAGCTCTCCAAGGA No data
Right 1026277020 7:68888929-68888951 CTGCCTGTGCTTTTAGAATTGGG No data
1026277016_1026277019 8 Left 1026277016 7:68888897-68888919 CCACTGTCACAGCTCTCCAAGGA No data
Right 1026277019 7:68888928-68888950 TCTGCCTGTGCTTTTAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026277016 Original CRISPR TCCTTGGAGAGCTGTGACAG TGG (reversed) Intergenic
No off target data available for this crispr