ID: 1026277022

View in Genome Browser
Species Human (GRCh38)
Location 7:68888933-68888955
Sequence CTGTGCTTTTAGAATTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026277017_1026277022 -3 Left 1026277017 7:68888913-68888935 CCAAGGACAAATTCCTCTGCCTG No data
Right 1026277022 7:68888933-68888955 CTGTGCTTTTAGAATTGGGCAGG No data
1026277016_1026277022 13 Left 1026277016 7:68888897-68888919 CCACTGTCACAGCTCTCCAAGGA No data
Right 1026277022 7:68888933-68888955 CTGTGCTTTTAGAATTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026277022 Original CRISPR CTGTGCTTTTAGAATTGGGC AGG Intergenic
No off target data available for this crispr