ID: 1026283370

View in Genome Browser
Species Human (GRCh38)
Location 7:68941692-68941714
Sequence CACGTGAACCCAGGAGACGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026283365_1026283370 17 Left 1026283365 7:68941652-68941674 CCTGTAATCTCAGCTACTCAGGA 0: 3587
1: 62991
2: 151514
3: 233690
4: 199225
Right 1026283370 7:68941692-68941714 CACGTGAACCCAGGAGACGGAGG No data
1026283363_1026283370 24 Left 1026283363 7:68941645-68941667 CCATGCTCCTGTAATCTCAGCTA No data
Right 1026283370 7:68941692-68941714 CACGTGAACCCAGGAGACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026283370 Original CRISPR CACGTGAACCCAGGAGACGG AGG Intergenic
No off target data available for this crispr