ID: 1026284147

View in Genome Browser
Species Human (GRCh38)
Location 7:68948375-68948397
Sequence AAGGAGGAGGAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10167
Summary {0: 3, 1: 64, 2: 391, 3: 2053, 4: 7656}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026284147_1026284154 4 Left 1026284147 7:68948375-68948397 CCCTCCTCTTTCTCCTCCTCCTT 0: 3
1: 64
2: 391
3: 2053
4: 7656
Right 1026284154 7:68948402-68948424 TCCTCAGTGTGAAGACAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026284147 Original CRISPR AAGGAGGAGGAGAAAGAGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr