ID: 1026285661

View in Genome Browser
Species Human (GRCh38)
Location 7:68960621-68960643
Sequence ATGGAATTTCTGTGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026285661_1026285662 -8 Left 1026285661 7:68960621-68960643 CCTGTTATTCACAGAAATTCCAT No data
Right 1026285662 7:68960636-68960658 AATTCCATTCCATAAAGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026285661 Original CRISPR ATGGAATTTCTGTGAATAAC AGG (reversed) Intergenic
No off target data available for this crispr