ID: 1026286037

View in Genome Browser
Species Human (GRCh38)
Location 7:68963581-68963603
Sequence TTTTATAAGGGGATCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026286023_1026286037 28 Left 1026286023 7:68963530-68963552 CCCAGCTAATTTTTGTATTTTTA 0: 58150
1: 129705
2: 102168
3: 63447
4: 65966
Right 1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG No data
1026286024_1026286037 27 Left 1026286024 7:68963531-68963553 CCAGCTAATTTTTGTATTTTTAG 0: 84164
1: 74614
2: 45566
3: 28364
4: 50515
Right 1026286037 7:68963581-68963603 TTTTATAAGGGGATCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026286037 Original CRISPR TTTTATAAGGGGATCCTGGA GGG Intergenic
No off target data available for this crispr