ID: 1026289083

View in Genome Browser
Species Human (GRCh38)
Location 7:68989791-68989813
Sequence ATGGAGACACAGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026289083_1026289088 21 Left 1026289083 7:68989791-68989813 CCTTCTTCCATCTGTGTCTCCAT No data
Right 1026289088 7:68989835-68989857 GCCCCAGTGTGAGCTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026289083 Original CRISPR ATGGAGACACAGATGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr