ID: 1026290160

View in Genome Browser
Species Human (GRCh38)
Location 7:68998874-68998896
Sequence CTGGTTCAACAGAAGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026290160_1026290168 12 Left 1026290160 7:68998874-68998896 CCTCAGGGCTTCTGTTGAACCAG No data
Right 1026290168 7:68998909-68998931 AGATTATACAGTGGTTCTAACGG No data
1026290160_1026290167 3 Left 1026290160 7:68998874-68998896 CCTCAGGGCTTCTGTTGAACCAG No data
Right 1026290167 7:68998900-68998922 GCTGGGGTCAGATTATACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026290160 Original CRISPR CTGGTTCAACAGAAGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr