ID: 1026295357

View in Genome Browser
Species Human (GRCh38)
Location 7:69047450-69047472
Sequence AATGCTTAGCTTGGCCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026295357_1026295361 8 Left 1026295357 7:69047450-69047472 CCAAGCTGGCCAAGCTAAGCATT No data
Right 1026295361 7:69047481-69047503 AGAAAGCAGAAAGCAGGCTAAGG No data
1026295357_1026295363 19 Left 1026295357 7:69047450-69047472 CCAAGCTGGCCAAGCTAAGCATT No data
Right 1026295363 7:69047492-69047514 AGCAGGCTAAGGCCTCCCTAGGG No data
1026295357_1026295365 21 Left 1026295357 7:69047450-69047472 CCAAGCTGGCCAAGCTAAGCATT No data
Right 1026295365 7:69047494-69047516 CAGGCTAAGGCCTCCCTAGGGGG No data
1026295357_1026295362 18 Left 1026295357 7:69047450-69047472 CCAAGCTGGCCAAGCTAAGCATT No data
Right 1026295362 7:69047491-69047513 AAGCAGGCTAAGGCCTCCCTAGG No data
1026295357_1026295360 2 Left 1026295357 7:69047450-69047472 CCAAGCTGGCCAAGCTAAGCATT No data
Right 1026295360 7:69047475-69047497 TGGAAGAGAAAGCAGAAAGCAGG No data
1026295357_1026295364 20 Left 1026295357 7:69047450-69047472 CCAAGCTGGCCAAGCTAAGCATT No data
Right 1026295364 7:69047493-69047515 GCAGGCTAAGGCCTCCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026295357 Original CRISPR AATGCTTAGCTTGGCCAGCT TGG (reversed) Intergenic
No off target data available for this crispr