ID: 1026295359

View in Genome Browser
Species Human (GRCh38)
Location 7:69047459-69047481
Sequence TCTTCCAGTAATGCTTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026295359_1026295360 -7 Left 1026295359 7:69047459-69047481 CCAAGCTAAGCATTACTGGAAGA No data
Right 1026295360 7:69047475-69047497 TGGAAGAGAAAGCAGAAAGCAGG No data
1026295359_1026295364 11 Left 1026295359 7:69047459-69047481 CCAAGCTAAGCATTACTGGAAGA No data
Right 1026295364 7:69047493-69047515 GCAGGCTAAGGCCTCCCTAGGGG No data
1026295359_1026295361 -1 Left 1026295359 7:69047459-69047481 CCAAGCTAAGCATTACTGGAAGA No data
Right 1026295361 7:69047481-69047503 AGAAAGCAGAAAGCAGGCTAAGG No data
1026295359_1026295365 12 Left 1026295359 7:69047459-69047481 CCAAGCTAAGCATTACTGGAAGA No data
Right 1026295365 7:69047494-69047516 CAGGCTAAGGCCTCCCTAGGGGG No data
1026295359_1026295362 9 Left 1026295359 7:69047459-69047481 CCAAGCTAAGCATTACTGGAAGA No data
Right 1026295362 7:69047491-69047513 AAGCAGGCTAAGGCCTCCCTAGG No data
1026295359_1026295363 10 Left 1026295359 7:69047459-69047481 CCAAGCTAAGCATTACTGGAAGA No data
Right 1026295363 7:69047492-69047514 AGCAGGCTAAGGCCTCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026295359 Original CRISPR TCTTCCAGTAATGCTTAGCT TGG (reversed) Intergenic
No off target data available for this crispr