ID: 1026295365

View in Genome Browser
Species Human (GRCh38)
Location 7:69047494-69047516
Sequence CAGGCTAAGGCCTCCCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026295359_1026295365 12 Left 1026295359 7:69047459-69047481 CCAAGCTAAGCATTACTGGAAGA No data
Right 1026295365 7:69047494-69047516 CAGGCTAAGGCCTCCCTAGGGGG No data
1026295357_1026295365 21 Left 1026295357 7:69047450-69047472 CCAAGCTGGCCAAGCTAAGCATT No data
Right 1026295365 7:69047494-69047516 CAGGCTAAGGCCTCCCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026295365 Original CRISPR CAGGCTAAGGCCTCCCTAGG GGG Intergenic
No off target data available for this crispr