ID: 1026297049

View in Genome Browser
Species Human (GRCh38)
Location 7:69062196-69062218
Sequence CAGGCTGCCCAGATATTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026297049_1026297056 28 Left 1026297049 7:69062196-69062218 CCACCAAATATCTGGGCAGCCTG No data
Right 1026297056 7:69062247-69062269 AGCCATCACAAGCATATAAATGG No data
1026297049_1026297057 29 Left 1026297049 7:69062196-69062218 CCACCAAATATCTGGGCAGCCTG No data
Right 1026297057 7:69062248-69062270 GCCATCACAAGCATATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026297049 Original CRISPR CAGGCTGCCCAGATATTTGG TGG (reversed) Intergenic
No off target data available for this crispr