ID: 1026301109

View in Genome Browser
Species Human (GRCh38)
Location 7:69098777-69098799
Sequence CAATGGGTGGGGAGTTCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026301103_1026301109 28 Left 1026301103 7:69098726-69098748 CCTGGGTGACAGAGAAAGACTTT No data
Right 1026301109 7:69098777-69098799 CAATGGGTGGGGAGTTCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026301109 Original CRISPR CAATGGGTGGGGAGTTCAGA AGG Intergenic
No off target data available for this crispr