ID: 1026309103

View in Genome Browser
Species Human (GRCh38)
Location 7:69168297-69168319
Sequence ATTAAGAGCCAGAATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026309101_1026309103 22 Left 1026309101 7:69168252-69168274 CCAACATACTTGGTACAGTTGGT No data
Right 1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026309103 Original CRISPR ATTAAGAGCCAGAATGAGGA CGG Intergenic
No off target data available for this crispr