ID: 1026309436

View in Genome Browser
Species Human (GRCh38)
Location 7:69170964-69170986
Sequence CGGGGACTTGCAACATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026309436_1026309443 6 Left 1026309436 7:69170964-69170986 CCCTCCAATGTTGCAAGTCCCCG No data
Right 1026309443 7:69170993-69171015 CAGCTTAATCCAAACTTGAGTGG No data
1026309436_1026309446 20 Left 1026309436 7:69170964-69170986 CCCTCCAATGTTGCAAGTCCCCG No data
Right 1026309446 7:69171007-69171029 CTTGAGTGGTAGTATCATGGAGG No data
1026309436_1026309445 17 Left 1026309436 7:69170964-69170986 CCCTCCAATGTTGCAAGTCCCCG No data
Right 1026309445 7:69171004-69171026 AAACTTGAGTGGTAGTATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026309436 Original CRISPR CGGGGACTTGCAACATTGGA GGG (reversed) Intergenic
No off target data available for this crispr