ID: 1026309970

View in Genome Browser
Species Human (GRCh38)
Location 7:69174961-69174983
Sequence ACTTTGTGAGCTCTGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026309967_1026309970 27 Left 1026309967 7:69174911-69174933 CCAAGAGGCAGAGGTTGCAGTGA 0: 2620
1: 53900
2: 104592
3: 141977
4: 105076
Right 1026309970 7:69174961-69174983 ACTTTGTGAGCTCTGTCTTCAGG No data
1026309966_1026309970 28 Left 1026309966 7:69174910-69174932 CCCAAGAGGCAGAGGTTGCAGTG 0: 1124
1: 32219
2: 105056
3: 164853
4: 190547
Right 1026309970 7:69174961-69174983 ACTTTGTGAGCTCTGTCTTCAGG No data
1026309968_1026309970 0 Left 1026309968 7:69174938-69174960 CCATCTCAAAAAAAAAAAAAAGG 0: 740
1: 14715
2: 106275
3: 72463
4: 94118
Right 1026309970 7:69174961-69174983 ACTTTGTGAGCTCTGTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026309970 Original CRISPR ACTTTGTGAGCTCTGTCTTC AGG Intergenic
No off target data available for this crispr