ID: 1026311457

View in Genome Browser
Species Human (GRCh38)
Location 7:69188939-69188961
Sequence GTGATTGAGGGCGTCTACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026311457_1026311461 14 Left 1026311457 7:69188939-69188961 CCACAGTAGACGCCCTCAATCAC No data
Right 1026311461 7:69188976-69188998 ATAAAGAATACAAGAAATACAGG No data
1026311457_1026311462 29 Left 1026311457 7:69188939-69188961 CCACAGTAGACGCCCTCAATCAC No data
Right 1026311462 7:69188991-69189013 AATACAGGCCTTCTCTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026311457 Original CRISPR GTGATTGAGGGCGTCTACTG TGG (reversed) Intergenic
No off target data available for this crispr