ID: 1026311458

View in Genome Browser
Species Human (GRCh38)
Location 7:69188951-69188973
Sequence TAGTATGGTACAGTGATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026311458_1026311461 2 Left 1026311458 7:69188951-69188973 CCCTCAATCACTGTACCATACTA No data
Right 1026311461 7:69188976-69188998 ATAAAGAATACAAGAAATACAGG No data
1026311458_1026311462 17 Left 1026311458 7:69188951-69188973 CCCTCAATCACTGTACCATACTA No data
Right 1026311462 7:69188991-69189013 AATACAGGCCTTCTCTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026311458 Original CRISPR TAGTATGGTACAGTGATTGA GGG (reversed) Intergenic
No off target data available for this crispr