ID: 1026311460

View in Genome Browser
Species Human (GRCh38)
Location 7:69188966-69188988
Sequence TTGTATTCTTTATCGTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026311460_1026311462 2 Left 1026311460 7:69188966-69188988 CCATACTACGATAAAGAATACAA No data
Right 1026311462 7:69188991-69189013 AATACAGGCCTTCTCTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026311460 Original CRISPR TTGTATTCTTTATCGTAGTA TGG (reversed) Intergenic
No off target data available for this crispr