ID: 1026311462

View in Genome Browser
Species Human (GRCh38)
Location 7:69188991-69189013
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026311457_1026311462 29 Left 1026311457 7:69188939-69188961 CCACAGTAGACGCCCTCAATCAC No data
Right 1026311462 7:69188991-69189013 AATACAGGCCTTCTCTAGTAAGG No data
1026311458_1026311462 17 Left 1026311458 7:69188951-69188973 CCCTCAATCACTGTACCATACTA No data
Right 1026311462 7:69188991-69189013 AATACAGGCCTTCTCTAGTAAGG No data
1026311459_1026311462 16 Left 1026311459 7:69188952-69188974 CCTCAATCACTGTACCATACTAC No data
Right 1026311462 7:69188991-69189013 AATACAGGCCTTCTCTAGTAAGG No data
1026311460_1026311462 2 Left 1026311460 7:69188966-69188988 CCATACTACGATAAAGAATACAA No data
Right 1026311462 7:69188991-69189013 AATACAGGCCTTCTCTAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026311462 Original CRISPR AATACAGGCCTTCTCTAGTA AGG Intergenic
No off target data available for this crispr