ID: 1026316025

View in Genome Browser
Species Human (GRCh38)
Location 7:69228396-69228418
Sequence CTGCAAATACAGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026316018_1026316025 25 Left 1026316018 7:69228348-69228370 CCTGTCAGGAGGTGGAGCTCAGG No data
Right 1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026316025 Original CRISPR CTGCAAATACAGATGAAGCT TGG Intergenic
No off target data available for this crispr