ID: 1026316309

View in Genome Browser
Species Human (GRCh38)
Location 7:69230700-69230722
Sequence TGCCACTGGGTGATGGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026316302_1026316309 13 Left 1026316302 7:69230664-69230686 CCATATGACGAGATTAGCAAAAA No data
Right 1026316309 7:69230700-69230722 TGCCACTGGGTGATGGGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026316309 Original CRISPR TGCCACTGGGTGATGGGTAT GGG Intergenic
No off target data available for this crispr